About   Help   FAQ
Rr513em1Ndav
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr513em1Ndav
Name: regulatory region 513; endonuclease-mediated mutation 1, Nadav Ahituv
MGI ID: MGI:7711743
Synonyms: PEC7 KO
Gene: Rr513  Location: Chr2:147408057-147409844 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr513em1Ndav page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsPax1 enhancer PEC7 was targeted using sgRNAs (equivalent to ACTCATTTGCCAAGACCCATGGG and TGATACTGTCCATAAACCTCAGG) with CRISPR/Cas9 technology, resulting in ~5.8 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147404882-147410717 (64-C, 67-C), 147404883-147410707 (70-E). (J:346374)
Expression
In Mice Carrying this Mutation: 20 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr513 Mutation:  0 strains or lines available
References
Original:  J:346374 Ushiki A, et al., Deletion of Pax1 scoliosis-associated regulatory elements leads to a female-biased tail abnormality. Cell Rep. 2024 Mar 8;43(3):113907
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory