Rr366694^em1Ndav
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr366694^em1Ndav
• Name: regulatory region 366694; endonuclease-mediated mutation 1, Nadav Ahituv
• MGI ID: MGI:7711741
• Synonyms: Xe1 KO
• Gene: Rr366694 Location: Chr2:147402075-147403763 bp, + strand Genetic Position: Chr2, Syntenic
• Alliance: Rr366694^em1Ndav page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Pax1 enhancer Xe1 was targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and ACTCATTTGCCAAGACCCATGGG) with CRISPR/Cas9 technology, resulting in ~3.2 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401677-147404891 (129-A), 147401678-147404882 (127-C), 147401675-147404886 (123-B). (J:346374)

Expression

In Mice Carrying this Mutation:

20 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr366694 Mutation: 0 strains or lines available

References

• Original: J:346374 Ushiki A, et al., Deletion of Pax1 scoliosis-associated regulatory elements leads to a female-biased tail abnormality. Cell Rep. 2024 Mar 8;43(3):113907
• All: 1 reference(s)