About   Help   FAQ
Rr366694em1Ndav
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr366694em1Ndav
Name: regulatory region 366694; endonuclease-mediated mutation 1, Nadav Ahituv
MGI ID: MGI:7711741
Synonyms: Xe1 KO
Gene: Rr366694  Location: Chr2:147402075-147403763 bp, + strand  Genetic Position: Chr2, Syntenic
Alliance: Rr366694em1Ndav page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation details

Pax1 enhancer Xe1 was targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and ACTCATTTGCCAAGACCCATGGG) with CRISPR/Cas9 technology, resulting in ~3.2 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401677-147404891 (129-A), 147401678-147404882 (127-C), 147401675-147404886 (123-B). (J:346374)

Expression
In Mice Carrying this Mutation: 20 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr366694 Mutation:  0 strains or lines available
References
Original:  J:346374 Ushiki A, et al., Deletion of Pax1 scoliosis-associated regulatory elements leads to a female-biased tail abnormality. Cell Rep. 2024 Mar 8;43(3):113907
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory