About   Help   FAQ
Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Michael Sasner
MGI ID: MGI:7711616
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Inserted expressed sequence, Reporter)
Mutation:    Insertion
 
Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn expresses 1 gene
 
Mutation detailssgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant tyrosyl-tRNA synthetase 1 (Yars1) gene into the Gt(ROSA)26Sor locus. The Yars1 gene contains a tyrosine to glycine mutation at amino acid 43 (Y43G). (J:101977, J:377841)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1084 strains or lines available
References
Original:  J:377841 Guldner IH, et al., Ageing promotes microglial accumulation of slow-degrading synaptic proteins. Nature. 2026 Jan 21;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory