Gt(ROSA)26Sor^{em3(CAG-GFP,-Yars1*Y43G)Msasn}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em3(CAG-GFP,-Yars1*Y43G)Msasn}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Michael Sasner
• MGI ID: MGI:7711616
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em3(CAG-GFP,-Yars1*Y43G)Msasn} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inserted expressed sequence, Reporter)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em3(CAG-GFP,-Yars1*Y43G)Msasn} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Yars1 (MGI:2147627)

• Mutation details: sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant tyrosyl-tRNA synthetase 1 (Yars1) gene into the Gt(ROSA)26Sor locus. The Yars1 gene contains a tyrosine to glycine mutation at amino acid 43 (Y43G). (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1095 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)