Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Michael Sasner |
| MGI ID: |
MGI:7711616 |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Inserted expressed sequence, Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn expresses
1 gene
|
| |
|
Mutation details: sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant tyrosyl-tRNA synthetase 1 (Yars1) gene into the Gt(ROSA)26Sor locus. The Yars1 gene contains a tyrosine to glycine mutation at amino acid 43 (Y43G).
(J:101977, J:377841)
|
|
|
|
|
| Original: |
J:377841 Guldner IH, et al., Ageing promotes microglial accumulation of slow-degrading synaptic proteins. Nature. 2026 Jan 21; |
| All: |
2 reference(s) |
|