About   Help   FAQ
Pfn3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pfn3em1(IMPC)J
Name: profilin 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7705311
Gene: Pfn3  Location: Chr13:55562501-55563045 bp, - strand  Genetic Position: Chr13, 30.06 cM, cytoband B2
Alliance: Pfn3em1(IMPC)J page
IMPC: Pfn3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCGTGAGCAGTGCTCTTAGT and CTACATCAGTGCAGTGCTGC. This resulted in a 396 bp deletion of Chr13:55,414,745-55,415,140 (GRCm38/mm10) that removes exon ENSMUSE00000352515. (J:188991, J:384794)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pfn3 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory