About   Help   FAQ
Rr499em2Jejo
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr499em2Jejo
Name: regulatory region 499; endonuclease-mediated mutation 2, Jane E Johnson
MGI ID: MGI:7705092
Synonyms: Ptf1aAR-DNT2
Gene: Rr499  Location: Chr2:19434901-19437198 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr499em2Jejo page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Ptf1a 5' enhancer was targeted by two sgRNAs (equivalent to CACAAGTGGCGACATTCCCA and CCGCAGAGCACGCCAGTCCG) using CRISPR/Cas9 technology, resulting in an ~1.2 kb deletion including the near autoregulatory PTF1-binding motif up to and including the TC-box of the far PTF1-binding motif, leaving its E-box intact. This allele was created in conjunction with the Rr500em2Jejo allele. (J:297165)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr499 Mutation:  0 strains or lines available
References
Original:  J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory