About   Help   FAQ
Zbtb21em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zbtb21em1(IMPC)J
Name: zinc finger and BTB domain containing 21; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7703526
Gene: Zbtb21  Location: Chr16:97746993-97763850 bp, - strand  Genetic Position: Chr16, 57.75 cM, cytoband C3-4
Alliance: Zbtb21em1(IMPC)J page
IMPC: Zbtb21 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATGAGCAGACACACAATTAA and CAGATAAAGTGCAGGATGGA. This resulted in a 3,196 bp deletion of Chr16:97,949,884-97,953,079 (GRCm38/mm10) that removes exon ENSMUSE00001260606. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zbtb21 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory