Jade1^em1Litl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jade1^em1Litl
• Name: jade family PHD finger 1; endonuclease-mediated mutation 1, Tangliang Li
• MGI ID: MGI:7665315
• Synonyms: Jade1^delta
• Gene: Jade1 Location: Chr3:41510169-41571299 bp, + strand Genetic Position: Chr3, 19.88 cM
• Alliance: Jade1^em1Litl page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs TCAGTATTTGAGCGGCGATATGG and GGGTCTCCCACTCCCGTAGGTGG deleted exons 3-9. (J:344221)

Expression

In Mice Carrying this Mutation:

4 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Jade1 Mutation: 98 strains or lines available

References

• Original: J:344221 Wang J, et al., JADE1 is dispensable for the brain development in mice. Biochem Biophys Res Commun. 2023 Dec 27;695:149421
• All: 1 reference(s)