About   Help   FAQ
Ctcfem1Hyao
Endonuclease-mediated Allele Detail
Summary
Symbol: Ctcfem1Hyao
Name: CCCTC-binding factor; endonuclease-mediated mutation 1, Hongjie Yao
MGI ID: MGI:7664135
Synonyms: CTCFR567W
Gene: Ctcf  Location: Chr8:106363200-106409554 bp, + strand  Genetic Position: Chr8, 53.04 cM
Alliance: Ctcfem1Hyao page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 567 (CGG) in exon 9 was changed to tryptophan (TGG) (p.R567W) using an sgRNA (equivalent to AAACATTCACCCGCCGGGTAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with autosomal dominant intellectual developmental disorder 21. (J:350502)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 57 assay results
5 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ctcf Mutation:  78 strains or lines available
References
Original:  J:350502 Zhang J, et al., CTCF mutation at R567 causes developmental disorders via 3D genome rearrangement and abnormal neurodevelopment. Nat Commun. 2024 Jul 1;15(1):5524
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory