About   Help   FAQ
Alx4em1Jian
Endonuclease-mediated Allele Detail
Summary
Symbol: Alx4em1Jian
Name: aristaless-like homeobox 4; endonuclease-mediated mutation 1, Rulang Jiang
MGI ID: MGI:7660788
Synonyms: Alx4f
Gene: Alx4  Location: Chr2:93472779-93511686 bp, + strand  Genetic Position: Chr2, 51.62 cM
Alliance: Alx4em1Jian page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/cas9 endonuclease-mediated genome editing, guide RNAs (AGAGGGGTCTTTAGCAGGTG and TTGCGTGGTGTTTAGCTGAG) were used to target to insert loxP into the introns flanking exon 2 of the aristaless-like homeobox 4 (Alx4) gene on chromosome 2. (J:349951)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alx4 Mutation:  21 strains or lines available
References
Original:  J:349951 Lan Y, et al., Lineage-specific requirements of Alx4 function in craniofacial and hair development. Dev Dyn. 2024 Mar 13;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory