Slc25a23^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a23^{em1(IMPC)Hmgu}
• Name: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:7645874
• Gene: Slc25a23 Location: Chr17:57350711-57366863 bp, - strand Genetic Position: Chr17, 29.64 cM
• Alliance: Slc25a23^{em1(IMPC)Hmgu} page
• IMPC: Slc25a23 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences ACAGAGGTTCCTATGTTACA, AGAGGTTCTTATACAGGTTG, TAACTTGGATGGGCAATCAT, and TTTGTCTTGTGTAGCGATGG that targeted exon(s) ENSMUSE00000139879.4 ENSMUSE00000139893.4 ENSMUSE00000412311.5 ENSMUSE00000541310.2 ENSMUSE00000909783.2 ENSMUSE00001213462.2 ENSMUSE00001308193.2 ENSMUSE00002034297.1 ENSMUSE00002034314.1 ENSMUSE00002034320.1 ENSMUSE00002034324.1. This resulted in deletion(s) of 5071 bp (location: Chr17:57359585-57364655; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc25a23 Mutation: 38 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)