App^em2Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: App^em2Aduci
• Name: amyloid beta precursor protein; endonuclease-mediated mutation 2, Frank LaFerla
• MGI ID: MGI:7645731
• Gene: App Location: Chr16:84751236-84972187 bp, - strand Genetic Position: Chr16, 46.92 cM, cytoband C3-qter
• Alliance: App^em2Aduci page

Mutation origin

• Strain of Origin: B6(Cg)-App^em1Aduci/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: A guide RNA (CACCAGGGTGATGACAATCA) was designed to produce the I716F (Iberian) mutation in exon 17 of the amyloid beta precursor protein (App) gene. Specifically, the mutations change an isoleucine (I) to phenylalanine (F) in APP. This targetted mutation was made in App zygote containing a loxP site upstream of exon 14, 3 point mutations inserted into exon 14 to create amino acid substitutions (amino acids 5 (G->R), 10 (F->Y) and 13 (R->H)) (ENSMUSE00000131684), a loxP site downstream of exon 14 and the KM670/671NL (Swedish) mutations in exon 16 of the amyloid beta precursor protein (App) gene. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any App Mutation: 111 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)