About   Help   FAQ
Ms4a18em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ms4a18em1(IMPC)J
Name: membrane-spanning 4-domains, subfamily A, member 18; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7643202
Gene: Ms4a18  Location: Chr19:10974388-10995390 bp, - strand  Genetic Position: Chr19, 7.5 cM
Alliance: Ms4a18em1(IMPC)J page
IMPC: Ms4a18 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCATAACTTGGACATTACTG and GCTATTCTGTCAACTATTTC. This resulted in a 16,393 bp deletion of Chr19:10,997,295-11,013,687 (GRCm38/mm10) that removes exons ENSMUSE00001053564 through ENSMUSE00001006950. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ms4a18 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory