About   Help   FAQ
Ccdc96em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc96em1(IMPC)J
Name: coiled-coil domain containing 96; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7643196
Gene: Ccdc96  Location: Chr5:36641932-36645515 bp, + strand  Genetic Position: Chr5, 19.14 cM, cytoband B2
Alliance: Ccdc96em1(IMPC)J page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAAAATGGACAGCCACTACG and AGGGGTGAAGCAAAAGATCA. This resulted in a 1,724 bp deletion of Chr5:36,484,659-36,486,382 (GRCm38/mm10) that removes exon ENSMUSE00000346252. (J:23000)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc96 Mutation:  21 strains or lines available
References
Original:  J:23000 MGD Nomenclature Committee, Nomenclature Committee Use. 1995-02-14;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory