Cfap184^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap184^em1(IMPC)J
• Name: cilia and flagella associated protein 184; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7643196
• Gene: Cfap184 Location: Chr5:36641932-36645515 bp, + strand Genetic Position: Chr5, 19.14 cM, cytoband B2
• Alliance: Cfap184^em1(IMPC)J page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGGGGTGAAGCAAAAGATCA and GAAAATGGACAGCCACTACG that targeted exon(s) ENSMUSE00000346252.4. This resulted in deletion(s) of 1724 bp (location: Chr5:36642003-36643726; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfap184 Mutation: 21 strains or lines available

References

• Original: J:23000 MGD Nomenclature Committee, Nomenclature Committee Use. 1995-02-14
• All: 2 reference(s)