Ccdc97^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc97^em1(IMPC)Mbp
• Name: coiled-coil domain containing 97; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7640114
• Gene: Ccdc97 Location: Chr7:25410537-25418460 bp, - strand Genetic Position: Chr7, 13.99 cM
• Alliance: Ccdc97^em1(IMPC)Mbp page
• IMPC: Ccdc97 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CGAGCACTCTAGCACTGCGA and CTATTGACTGTGCAGCATCA that targeted exon(s) ENSMUSE00001240780.2 ENSMUSE00001249827.2 ENSMUSE00001306292.2. This resulted in deletion(s) of 2075 bp (location: Chr7:25413705-25415779; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc97 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)