Pigylem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pigylem1(IMPC)Mbp |
| Name: |
phosphatidylinositol glycan anchor biosynthesis, class Y-like; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:7638748 |
| Gene: |
Pigyl Location: Chr9:22068142-22069651 bp, + strand Genetic Position: Chr9, 8.46 cM, cytoband A4
|
| Alliance: |
Pigylem1(IMPC)Mbp page
|
| IMPC: |
Pigyl gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AACCGCTGCGTGTGACGCGG and CTTCACCATTGACCTTGAAG that targeted exon(s) ENSMUSE00002134606.1 ENSMUSE00002134605.1 ENSMUSE00002195719.1. This resulted in deletion(s) of 2 bp (location: Chr9:22068936-22068937; GRCm39), 1105 bp (location: Chr9:22069102-22070206; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|