About   Help   FAQ
Gt(ROSA)26Sorem1(ACE2)Brle
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem1(ACE2)Brle
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Brendan Lee
MGI ID: MGI:7628005
Synonyms: Rosa26hACE2
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem1(ACE2)Brle page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Inserted expressed sequence)
Mutation:    Insertion
 
Gt(ROSA)26Sorem1(ACE2)Brle expresses 1 gene
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-genome editing, a guide RNA [ACTCCAGTCTTTCTAGAAGA (PAM: TGG)] was selected to introduce a loxP-flanked STOP (with stop codons in all 3 reading frames and a triple polyA signal) cassette, human angiotensin converting enzyme 2 (ACE2) cDNA, and a polyA signal sequence, into the Gt(ROSA)26Sor locus. (J:347762)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1084 strains or lines available
References
Original:  J:347762 Song IW, et al., Generation of a humanized mAce2 and a conditional hACE2 mouse models permissive to SARS-COV-2 infection. Mamm Genome. 2024 Mar 15;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory