Tma16^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tma16^em1(IMPC)Tcp
• Name: translation machinery associated 16; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7624396
• Gene: Tma16 Location: Chr8:66928995-66939182 bp, - strand Genetic Position: Chr8, 33.14 cM, cytoband B3.3
• Alliance: Tma16^em1(IMPC)Tcp page
• IMPC: Tma16 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AGTGACTCGGTCACATTAGA and TTAACTGGTAAGGCTCGGGT that targeted exon(s) ENSMUSE00000151985.2 ENSMUSE00001228891.2 ENSMUSE00001234942.2 ENSMUSE00001270930.2. This resulted in deletion(s) of 4468 bp (location: Chr8:66932825-66937292; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tma16 Mutation: 20 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)