Mrpl53em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mrpl53em1(IMPC)Mbp |
| Name: |
mitochondrial ribosomal protein L53; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:7624393 |
| Gene: |
Mrpl53 Location: Chr6:83086089-83086913 bp, + strand Genetic Position: Chr6, 35.94 cM, cytoband D1
|
| Alliance: |
Mrpl53em1(IMPC)Mbp page
|
| IMPC: |
Mrpl53 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CGGCTCCGCGGTACTTCGCG and GGTGAAGGGCCCCGACAAAT that targeted exon(s) ENSMUSE00000697503.3 ENSMUSE00001230918.2 ENSMUSE00001266981.2 ENSMUSE00001715192.1 ENSMUSE00001715199.1. This resulted in deletion(s) of 838 bp (location: Chr6:83086002-83086839; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|