About   Help   FAQ
Ngfem1Bshn
Endonuclease-mediated Allele Detail
Summary
Symbol: Ngfem1Bshn
Name: nerve growth factor; endonuclease-mediated mutation 1, Bo Shen
MGI ID: MGI:7624257
Synonyms: NgfmScarlet
Gene: Ngf  Location: Chr3:102377235-102428329 bp, + strand  Genetic Position: Chr3, 45.25 cM
Alliance: Ngfem1Bshn page
Mutation
origin
Strain of Origin:  C57BL/6Ka
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailssgRNAs (CAATAGCTGCCCGAGTGACAGGG and AGTGTTTGGAGTCGATGCCCCGG)were designed to insert a red fluorescent protein (mScarlet) sequence, and woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) followed by a polyadenylation signal (mScarlet-WPRE-pA) after an alternative ATG start codon in exon 4, replacing most of the coding sequence in exon 4 of the endogenous nerve growth factor (Ngf) gene. (J:347437)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ngf Mutation:  12 strains or lines available
References
Original:  J:347437 Gao X, et al., Leptin receptor(+) cells promote bone marrow innervation and regeneration by synthesizing nerve growth factor. Nat Cell Biol. 2023 Nov 27;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory