About   Help   FAQ
Apoeem1Aduci
Endonuclease-mediated Allele Detail
Summary
Symbol: Apoeem1Aduci
Name: apolipoprotein E; endonuclease-mediated mutation 1, Frank LaFerla
MGI ID: MGI:7622033
Gene: Apoe  Location: Chr7:19430034-19433113 bp, - strand  Genetic Position: Chr7, 9.94 cM
Alliance: Apoeem1Aduci page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing CRISPR/Cas9 technology, a guide RNA (gcacagaggagatacgggcg) was designed to produce a CGG to TCT missense mutation resulting in an arginine to serine mutation (R128S) in the apolipoprotein E (Apoe) gene. The missense mutation corresponds to the human SNP rs121918393 found in human APOE mature protein and is associated with an increased risk of Alzheimers disease (AD). (J:101977, J:361570)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Apoe Mutation:  163 strains or lines available
References
Original:  J:361570 Tran KM, et al., APOE Christchurch enhances a disease-associated microglial response to plaque but suppresses response to tau pathology. Mol Neurodegener. 2025 Jan 22;20(1):9
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory