Nmd3em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nmd3em1(IMPC)Tcp |
| Name: |
NMD3 ribosome export adaptor; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:7621905 |
| Gene: |
Nmd3 Location: Chr3:69629354-69656380 bp, + strand Genetic Position: Chr3, 32.25 cM
|
| Alliance: |
Nmd3em1(IMPC)Tcp page
|
| IMPC: |
Nmd3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AAGTAGGAACCCGAACTAAG and AGCAGTAGTGCCTATTACTA that targeted exon(s) ENSMUSE00000172995.4 ENSMUSE00001214243.2 ENSMUSE00001224374.2 ENSMUSE00001294158.2. This resulted in deletion(s) of 7425 bp (location: Chr3:69635241-69642665; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|