About   Help   FAQ
Garin2em1Maq
Endonuclease-mediated Allele Detail
Summary
Symbol: Garin2em1Maq
Name: golgi associated RAB2 interactor 2; endonuclease-mediated mutation 1, Qian Ma
MGI ID: MGI:7620297
Synonyms: FAM71D-
Gene: Garin2  Location: Chr12:78738309-78781290 bp, + strand  Genetic Position: Chr12, 35.51 cM, cytoband D2
Alliance: Garin2em1Maq page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology using gRNAs GCTTAGGAAATGGGGGGTTG and TAGTGAATCCTTCTGACAAA generated a 73 bp deletion in exon 4, which resulted in the mutation of valine at amino acid 70 to leucine and a frameshift mutation that causes a premature stop at amino acid 82. Western blot analysis and immunofluorescence confirmed absence of protein in testis lysates. (J:344724)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Garin2 Mutation:  34 strains or lines available
References
Original:  J:344724 Mo S, et al., FAM71D is dispensable for spermatogenesis and male fertility in mice. Mol Reprod Dev. 2023 Dec;90(12):804-809
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory