About   Help   FAQ
Igs80em1Aven
Endonuclease-mediated Allele Detail
Summary
Symbol: Igs80em1Aven
Name: intergenic site 80; endonuclease-mediated mutation 1, Andrea Ventura
MGI ID: MGI:7620008
Gene: Igs80  Location: Chr10:117838359-117838360 bp  Genetic Position: Chr10, Syntenic
Alliance: Igs80em1Aven page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsGuide RNAs (TCTTACAGCATACTACGGTC and TTCTGCGATTCGTTATGCGT) were designed to insert loxP sites flanking a 1.3 Mbp genomic region on chromosome 10 (chr10:116711442-18002454), spanning from the Myrfl gene to the Rap1b gene, including the Mdm2 gene. This allele is a distal loxP insertion site that pairs with Igs79. (J:346905)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Igs80 Mutation:  1 strain or line available
References
Original:  J:346905 Pradella D, et al., Immortalization and transformation of primary cells mediated by engineered ecDNAs. bioRxiv. 2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory