Igs80^em1Aven
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igs80^em1Aven
• Name: intergenic site 80; endonuclease-mediated mutation 1, Andrea Ventura
• MGI ID: MGI:7620008
• Gene: Igs80 Location: unknown Genetic Position: Chr10, Syntenic
• Alliance: Igs80^em1Aven page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: Guide RNAs (TCTTACAGCATACTACGGTC and TTCTGCGATTCGTTATGCGT) were designed to insert loxP sites flanking a 1.3 Mbp genomic region on chromosome 10 (chr10:116711442-18002454), spanning from the Myrfl gene to the Rap1b gene, including the Mdm2 gene. This allele is a distal loxP insertion site that pairs with Igs79. (J:346905)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Igs80 Mutation: 1 strain or line available

References

• Original: J:346905 Pradella D, et al., Immortalization and transformation of primary cells mediated by engineered ecDNAs. bioRxiv. 2023
• All: 1 reference(s)