Hcfc1r1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Hcfc1r1em1(IMPC)Mbp |
| Name: |
host cell factor C1 regulator 1 (XPO1-dependent); endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:7619079 |
| Gene: |
Hcfc1r1 Location: Chr17:23892570-23894201 bp, + strand Genetic Position: Chr17, 11.98 cM
|
| Alliance: |
Hcfc1r1em1(IMPC)Mbp page
|
| IMPC: |
Hcfc1r1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CAGGCACGTCCGGAATCGAG and GGAGCCAGTCGGCCACTGCG that targeted exon(s) ENSMUSE00000136264.2 ENSMUSE00000612379.2 ENSMUSE00000612380.5 ENSMUSE00000753925.2 ENSMUSE00000986111.2 ENSMUSE00001022658.2 ENSMUSE00001755001.1 ENSMUSE00001755583.1 ENSMUSE00001755586.1 ENSMUSE00001755587.1 ENSMUSE00002112453.1 ENSMUSE00002112454.1 ENSMUSE00002145576.1 ENSMUSE00002176869.1 ENSMUSE00002176870.1 ENSMUSE00002176871.1 ENSMUSE00002176872.1 ENSMUSE00002189013.1. This resulted in deletion(s) of 1783 bp (location: Chr17:23892581-23894363; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|