Impg2^em3Bdph
Endonuclease-mediated Allele Detail

Summary

• Symbol: Impg2^em3Bdph
• Name: interphotoreceptor matrix proteoglycan 2; endonuclease-mediated mutation 3, Benjamin Philpot
• MGI ID: MGI:7619046
• Synonyms: Impg2^T807Ter
• Gene: Impg2 Location: Chr16:56024676-56094119 bp, + strand Genetic Position: Chr16, 33.91 cM
• Alliance: Impg2^em3Bdph page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Two nucleotides (CA) were deleted from exon 14 using an sgRNA (equivalent to GAGAGCACTGACAGACTCTGG) and an ssoDN template with CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.T807*fs*1). The mutation models the human two-nucleotide (TG) deletion at a similar position (A805) associated with adult-onset vitelliform macular dystrophy (AVMD) and retinitis pigmentosa (RP). (J:346749)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Impg2 Mutation: 69 strains or lines available

References

• Original: J:346749 Williams BN, et al., Heterogeneity in the progression of retinal pathologies in mice harboring patient mimicking Impg2 mutations. Hum Mol Genet. 2024 Feb 18;33(5):448-464
• All: 1 reference(s)