About   Help   FAQ
Fxnem8Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Fxnem8Lutzy
Name: frataxin; endonuclease-mediated mutation 8, Cathy Lutz
MGI ID: MGI:7616951
Synonyms: FxnG127V
Gene: Fxn  Location: Chr19:24238817-24257969 bp, - strand  Genetic Position: Chr19, 19.39 cM, cytoband C1
Alliance: Fxnem8Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsGlycine codon 127 (GGC) in exon 4 was changed to valine (GTC) (c.380G>T:p.G127V) using an sgRNA (equivalent to TGCCACCTGACCCCCTAGGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the c.389G>T:p.G130V human mutation associated with Friedreich ataxia (FRDA). Transcription from this allele is normal, but translation is at about 5% of normal. (J:299300)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fxn Mutation:  42 strains or lines available
References
Original:  J:299300 Fil D, et al., Mitochondrial damage and senescence phenotype of cells derived from a novel frataxin G127V point mutation mouse model of Friedreich's ataxia. Dis Model Mech. 2020 Jun 25;:dmm045229
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory