Naa10^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Naa10^em1Lutzy
• Name: N(alpha)-acetyltransferase 10, NatA catalytic subunit; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:7614520
• Gene: Naa10 Location: ChrX:72960479-72965550 bp, - strand Genetic Position: ChrX, 37.49 cM
• Alliance: Naa10^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA (TCTGAGCCAGGCCAAGGCGC), and a single-stranded oligo donor carrying the missense R83C (CGC toTGC, arginine to cysteine) variant and a silent R82R (CGG to AGA) mutation, were introduced by HDR-mediated genome editing. The R83C missense and R82R silent mutations are in exon 5 of the N(alpha)-acetyltransferase 10, NatA catalytic subunit (Naa10) gene on chromosome X, and correspond to be mutations associated with developmental delay, attention-deficit/hyperactive disorder (ADHD) like behavior and cardiac abnormalities in human. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Naa10 Mutation: 10 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)