Cdca7^em1Ldax
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdca7^em1Ldax
• Name: cell division cycle associated 7; endonuclease-mediated mutation 1, Lucia Daxinger
• MGI ID: MGI:7614313
• Synonyms: Cdca7^G305V
• Gene: Cdca7 Location: Chr2:72306540-72317237 bp, + strand Genetic Position: Chr2, 43.35 cM
• Alliance: Cdca7^em1Ldax page

Mutation origin

• Strain of Origin: FVB/NJ-Tg(HBA1-GFP)1Ew/Ew

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 305 (GGC) in exon 7 was changed to valine (GTC) (c.914G>T;p.G305V) using an sgRNA(targeting AGGGACCACAGAATTGGCCCCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the carboxyterminal 4-CXXCtype zinc finger (ZF) domain of the encoded peptide, is the equivalent of the human c.881G>T; p.Gly294Val mutation associated with immunodeficiency, centromeric instability, facial anomalies syndrome 3 (ICF3). (J:345314)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdca7 Mutation: 27 strains or lines available

References

• Original: J:345314 Vukic M, et al., CDCA7-associated global aberrant DNA hypomethylation translates to localized, tissue-specific transcriptional responses. Sci Adv. 2024 Feb 9;10(6):eadk3384
• All: 1 reference(s)