About   Help   FAQ
Rbm28em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbm28em1(IMPC)J
Name: RNA binding motif protein 28; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7612606
Gene: Rbm28  Location: Chr6:29123572-29164975 bp, - strand  Genetic Position: Chr6, 12.33 cM
Alliance: Rbm28em1(IMPC)J page
IMPC: Rbm28 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CTTTTCCCATATTATTGAAT and GCTTAGCAGAAAGGAATGAA. This resulted in a 447 bp deletion of Chr6:29,158,595-29,159,041 (GRCm38/mm10) and removes exon ENSMUSE00001287926. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rbm28 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory