About   Help   FAQ
Muc6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Muc6em1(IMPC)J
Name: mucin 6, gastric; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7612604
Gene: Muc6  Location: Chr7:141213373-141241641 bp, - strand  Genetic Position: Chr7, 87.03 cM, cytoband F5
Alliance: Muc6em1(IMPC)J page
IMPC: Muc6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTCTCAATAGCTAGTACTGG and GTCTAGGCTAAGCTGGAACA. This resulted in a 2,985 bp deletion of Chr7:141,647,405-141,650,389 (GRCm38/mm10) and removes exon ENSMUSE00000338948 through ENSMUSE00000151335. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Muc6 Mutation:  156 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory