About   Help   FAQ
Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam
Targeted Allele Detail
Summary
Symbol: Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam
Name: collagen, type I, alpha 1; targeted mutation 3, Tuomas Tammela
MGI ID: MGI:7610035
Gene: Col1a1  Location: Chr11:94827050-94843868 bp, + strand  Genetic Position: Chr11, 59.01 cM, cytoband D
Alliance: Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:345354
Parent Cell Line:  KH2 (ES Cell)
Strain of Origin:  (C57BL/6 x 129S4/SvJae)F1
Mutation
description
Allele Type:    Targeted (Inducible, Knockdown, RMCE-ready, Reporter)
Inducer:    doxycycline/tetracycline
Mutation:    Insertion
 
Mutation detailsThe targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras (ACTTGACGATACAGCTAATTC) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras247 indicates that the position of the first base pair bound by the shRNA seed sequence is 247 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette. (J:345354)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Col1a1 Mutation:  166 strains or lines available
References
Original:  J:345354 Li Z, et al., Alveolar Differentiation Drives Resistance to KRAS Inhibition in Lung Adenocarcinoma. Cancer Discov. 2024 Feb 8;14(2):308-325
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory