Col1a1^{tm3(tetO-GFP/RNAi:Kras247)Ttam}
Targeted Allele Detail

Summary

• Symbol: Col1a1^{tm3(tetO-GFP/RNAi:Kras247)Ttam}
• Name: collagen, type I, alpha 1; targeted mutation 3, Tuomas Tammela
• MGI ID: MGI:7610035
• Gene: Col1a1 Location: Chr11:94827050-94843868 bp, + strand Genetic Position: Chr11, 59.01 cM, cytoband D
• Alliance: Col1a1^{tm3(tetO-GFP/RNAi:Kras247)Ttam} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:345354
• Parent Cell Line: KH2 (ES Cell)
• Strain of Origin: (C57BL/6 x 129S4/SvJae)F1

Mutation description

• Allele Type: Targeted (Inducible, Knockdown, RMCE-ready, Reporter)
• Inducer: doxycycline/tetracycline
• Mutation: Insertion
• Mutation details: The targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras (ACTTGACGATACAGCTAATTC) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras247 indicates that the position of the first base pair bound by the shRNA seed sequence is 247 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette. (J:345354)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Col1a1 Mutation: 166 strains or lines available

References

• Original: J:345354 Li Z, et al., Alveolar Differentiation Drives Resistance to KRAS Inhibition in Lung Adenocarcinoma. Cancer Discov. 2024 Feb 8;14(2):308-325
• All: 1 reference(s)