Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam
Targeted Allele Detail
|
|
| Symbol: |
Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam |
| Name: |
collagen, type I, alpha 1; targeted mutation 3, Tuomas Tammela |
| MGI ID: |
MGI:7610035 |
| Gene: |
Col1a1 Location: Chr11:94827050-94843868 bp, + strand Genetic Position: Chr11, 59.01 cM, cytoband D
|
| Alliance: |
Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam page
|
|
|
|
| Allele Type: |
|
Targeted (Inducible, Knockdown, RMCE-ready, Reporter) |
| Inducer: |
|
doxycycline/tetracycline |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: The targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras (ACTTGACGATACAGCTAATTC) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras247 indicates that the position of the first base pair bound by the shRNA seed sequence is 247 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette.
(J:345354)
|
|
|
|
|
| Original: |
J:345354 Li Z, et al., Alveolar Differentiation Drives Resistance to KRAS Inhibition in Lung Adenocarcinoma. Cancer Discov. 2024 Feb 8;14(2):308-325 |
| All: |
1 reference(s) |
|