About   Help   FAQ
Ccdc13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc13em1(IMPC)J
Name: coiled-coil domain containing 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7608139
Gene: Ccdc13  Location: Chr9:121626693-121668527 bp, - strand  Genetic Position: Chr9, 72.63 cM, cytoband F4
Alliance: Ccdc13em1(IMPC)J page
IMPC: Ccdc13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGACTGCTCTAAGGCTACAA and CAGCTGTTCAGAGCATCAGC. This resulted in a 2,600 bp deletion of Chr9:121,824,851-121,827,450 (GRCm38/mm10) and removes exons ENSMUSE00001302039 and ENSMUSE00001242639 (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc13 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory