Cbx2^em3Rek
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbx2^em3Rek
• Name: chromobox 2; endonuclease-mediated mutation 3, Robert E Kingston
• MGI ID: MGI:7606828
• Synonyms: Cbx2^HA
• Gene: Cbx2 Location: Chr11:118913845-118922101 bp, + strand Genetic Position: Chr11, 83.33 cM
• Alliance: Cbx2^em3Rek page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS). (J:340283)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cbx2 Mutation: 38 strains or lines available

References

• Original: J:340283 Kim JJ, et al., Cell type-specific role of CBX2 and its disordered region in spermatogenesis. Genes Dev. 2023 Jul 1;37(13-14):640-660
• All: 1 reference(s)