Cbx2em3Rek
Endonuclease-mediated Allele Detail
|
Symbol: |
Cbx2em3Rek |
Name: |
chromobox 2; endonuclease-mediated mutation 3, Robert E Kingston |
MGI ID: |
MGI:7606828 |
Synonyms: |
Cbx2HA |
Gene: |
Cbx2 Location: Chr11:118913845-118922101 bp, + strand Genetic Position: Chr11, 83.33 cM
|
Alliance: |
Cbx2em3Rek page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Epitope tag) |
Mutation: |
|
Insertion
|
|
|
Mutation details: Two tandem HA epitopes were inserted in-frame into the N terminus of the endogenous Cbx2 locus. The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS).
(J:340283)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Cbx2 Mutation: |
39 strains or lines available
|
|
Original: |
J:340283 Kim JJ, et al., Cell type-specific role of CBX2 and its disordered region in spermatogenesis. Genes Dev. 2023 Jul 1;37(13-14):640-660 |
All: |
1 reference(s) |
|