About   Help   FAQ
Cbx2em3Rek
Endonuclease-mediated Allele Detail
Summary
Symbol: Cbx2em3Rek
Name: chromobox 2; endonuclease-mediated mutation 3, Robert E Kingston
MGI ID: MGI:7606828
Synonyms: Cbx2HA
Gene: Cbx2  Location: Chr11:118913845-118922101 bp, + strand  Genetic Position: Chr11, 83.33 cM
Alliance: Cbx2em3Rek page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsTwo tandem HA epitopes were inserted in-frame into the N terminus of the endogenous Cbx2 locus. The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS). (J:340283)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cbx2 Mutation:  39 strains or lines available
References
Original:  J:340283 Kim JJ, et al., Cell type-specific role of CBX2 and its disordered region in spermatogenesis. Genes Dev. 2023 Jul 1;37(13-14):640-660
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory