Kcng1em2Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcng1em2Tcp |
| Name: |
potassium voltage-gated channel, subfamily G, member 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:7587753 |
| Gene: |
Kcng1 Location: Chr2:168102037-168123453 bp, - strand Genetic Position: Chr2, 88.55 cM
|
| Alliance: |
Kcng1em2Tcp page
|
| IMPC: |
Kcng1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, No functional change) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences AGGTGGCGCTGACTTAACAT and GACACTAGGGACAACAACTG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking the coding region; the 5' loxP site is upstream of the first coding exon (ENSMUSE00000639008) and the 3' loxP is 16bp 3' of the stop codon (GRCm38). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele.
(J:200814)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Kcng1 Mutation: |
29 strains or lines available
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|