About   Help   FAQ
Trim33em1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Trim33em1Lmjn
Name: tripartite motif-containing 33; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7580737
Gene: Trim33  Location: Chr3:103186609-103266086 bp, + strand  Genetic Position: Chr3, 45.25 cM
Alliance: Trim33em1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TATGTAATCGGCAACATCGC targeting the 5' side and AAACTCTACCTCAGGTTCGA targeting the 3' side of a critical region (ENSMUSE00000494738). This resulted in a 3950-bp deletion of Chr3 from 103242223 to103245812 (GRCm39) introducing a frameshift and a premature stop codon. (J:344138)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Trim33 Mutation:  76 strains or lines available
References
Original:  J:344138 The Centre for Phenogenomics, Strains and alleles submitted by The Centre for Phenogenomics. MGI Direct Data Submission. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory