About   Help   FAQ
Slc17a4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc17a4em1(IMPC)J
Name: solute carrier family 17 (sodium phosphate), member 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7579050
Gene: Slc17a4  Location: Chr13:24081862-24098992 bp, - strand  Genetic Position: Chr13, 9.98 cM
Alliance: Slc17a4em1(IMPC)J page
IMPC: Slc17a4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAATGTCCAAAATTAGTCA and ACCTGTTTATCCAAACAACG. This resulted in a 1086 bp deletion of Chr13:23,904,591-23,905,676 (GRCm38/mm10) that removes exons ENSMUSE00000491519, ENSMUSE00000517959, and ENSMUSE00000518852. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc17a4 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory