Kdm2bem1Xuwu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kdm2bem1Xuwu |
| Name: |
lysine (K)-specific demethylase 2B; endonuclease-mediated mutation 1, Xudong Wu |
| MGI ID: |
MGI:7578911 |
| Synonyms: |
Kdm2b-H283A |
| Gene: |
Kdm2b Location: Chr5:123008727-123127333 bp, - strand Genetic Position: Chr5, 62.63 cM, cytoband F
|
| Alliance: |
Kdm2bem1Xuwu page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Histidine codon 283 (CAT) in exon 9 was changed to alanine (GCT) (p.H283A) using an sgRNA (targeting TGGACTCTCTGGTGTTCGGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive.
(J:342729)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Kdm2b Mutation: |
219 strains or lines available
|
|
| Original: |
J:342729 Huo D, et al., CpG island reconfiguration for the establishment and synchronization of polycomb functions upon exit from naive pluripotency. Mol Cell. 2022 Mar 17;82(6):1169-1185.e7 |
| All: |
1 reference(s) |
|