About   Help   FAQ
Kdm2bem1Xuwu
Endonuclease-mediated Allele Detail
Summary
Symbol: Kdm2bem1Xuwu
Name: lysine (K)-specific demethylase 2B; endonuclease-mediated mutation 1, Xudong Wu
MGI ID: MGI:7578911
Synonyms: Kdm2b-H283A
Gene: Kdm2b  Location: Chr5:123008727-123127333 bp, - strand  Genetic Position: Chr5, 62.63 cM, cytoband F
Alliance: Kdm2bem1Xuwu page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsHistidine codon 283 (CAT) in exon 9 was changed to alanine (GCT) (p.H283A) using an sgRNA (targeting TGGACTCTCTGGTGTTCGGC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide catalytically inactive. (J:342729)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kdm2b Mutation:  219 strains or lines available
References
Original:  J:342729 Huo D, et al., CpG island reconfiguration for the establishment and synchronization of polycomb functions upon exit from naive pluripotency. Mol Cell. 2022 Mar 17;82(6):1169-1185.e7
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory