About   Help   FAQ
Ppp6r1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppp6r1em1(IMPC)J
Name: protein phosphatase 6, regulatory subunit 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7577005
Gene: Ppp6r1  Location: Chr7:4634494-4661949 bp, - strand  Genetic Position: Chr7, 2.68 cM
Alliance: Ppp6r1em1(IMPC)J page
IMPC: Ppp6r1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CATAGAACATAATCTGAAGG and CATCCAGCATTAGGCTCAGG. This resulted in a 692 bp deletion of Chr7:4,642,957-4,643,648(GRCm38/mm10) that removes exons ENSMUSE00000415805, ENSMUSE00000415802, and ENSMUSE00000415797. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppp6r1 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory