Wee2^em3(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wee2^em3(IMPC)J
• Name: WEE1 homolog 2 (S. pombe); endonuclease-mediated mutation 3, Jackson
• MGI ID: MGI:7576991
• Gene: Wee2 Location: Chr6:40416022-40443747 bp, + strand Genetic Position: Chr6, 18.82 cM
• Alliance: Wee2^em3(IMPC)J page
• IMPC: Wee2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CGGCCATCTCAGTGCAGACA and CCGTGGGACATCCTCCGTGT. This resulted in a 21,994 bp deletion of Chr6:40,443,966-40,465,959 (GRCm38/mm10) removing exons ENSMUSE00000266547, ENSMUSE00000266539, ENSMUSE00000416138, ENSMUSE00000266530, ENSMUSE00000266525, ENSMUSE00000266519, ENSMUSE00000266519, ENSMUSE00000266506, ENSMUSE00000266499, ENSMUSE00000266493, ENSMUSE00000266485 (exons 2-12) that contain the entire protein coding sequence. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wee2 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)