Wee2em3(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Wee2em3(IMPC)J |
Name: |
WEE1 homolog 2 (S. pombe); endonuclease-mediated mutation 3, Jackson |
MGI ID: |
MGI:7576991 |
Gene: |
Wee2 Location: Chr6:40416022-40443747 bp, + strand Genetic Position: Chr6, 18.82 cM
|
Alliance: |
Wee2em3(IMPC)J page
|
IMPC: |
Wee2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CGGCCATCTCAGTGCAGACA and CCGTGGGACATCCTCCGTGT. This resulted in a 21,994 bp deletion of Chr6:40,443,966-40,465,959 (GRCm38/mm10) removing exons ENSMUSE00000266547, ENSMUSE00000266539, ENSMUSE00000416138, ENSMUSE00000266530, ENSMUSE00000266525, ENSMUSE00000266519, ENSMUSE00000266519, ENSMUSE00000266506, ENSMUSE00000266499, ENSMUSE00000266493, ENSMUSE00000266485 (exons 2-12) that contain the entire protein coding sequence.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|