Rgs17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgs17^em1(IMPC)J
• Name: regulator of G-protein signaling 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7574257
• Gene: Rgs17 Location: Chr10:5775663-5872400 bp, - strand Genetic Position: Chr10, 1.91 cM
• Alliance: Rgs17^em1(IMPC)J page
• IMPC: Rgs17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GATAAATAACCGAAGCACTG and GCAAAACCTGGACCAGTAGA. This resulted in a 540 bp deletion of Chr10:5,841,189-5,841,728 (GRCm38/mm10) that removes exon ENSMUSE00000097978. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rgs17 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)