About   Help   FAQ
Tfebem1Xinli
Endonuclease-mediated Allele Detail
Summary
Symbol: Tfebem1Xinli
Name: transcription factor EB; endonuclease-mediated mutation 1, Xinjian Li
MGI ID: MGI:7572842
Synonyms: TFEB C270S
Gene: Tfeb  Location: Chr17:48047962-48103341 bp, + strand  Genetic Position: Chr17, 23.99 cM, cytoband D
Alliance: Tfebem1Xinli page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsCysteine codon 270 (TGC) in exon 4 was changed to serine (AGC) (p.C270S) using an sgRNA (targeting GCTTCTGAGTCAGGTCGGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks alkylation of the residue in the encoded peptide. (J:342735)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tfeb Mutation:  45 strains or lines available
References
Original:  J:342735 Zhang Z, et al., Itaconate is a lysosomal inducer that promotes antibacterial innate immunity. Mol Cell. 2022 Aug 4;82(15):2844-2857.e10
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory