About   Help   FAQ
Pklrem1Appsc
Endonuclease-mediated Allele Detail
Summary
Symbol: Pklrem1Appsc
Name: pyruvate kinase liver and red blood cell; endonuclease-mediated mutation 1, Applied StemCell
MGI ID: MGI:7572604
Synonyms: Pklr-, Pklr KO
Gene: Pklr  Location: Chr3:89043449-89054091 bp, + strand  Genetic Position: Chr3, 39.01 cM
Alliance: Pklrem1Appsc page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s), Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA single nucleotide (G) was deleted from alternative exon 1 (from MetGlu codons ATGGAA) using sgRNAs (targeting ACAGCAGGTACGCAGCAGTATGG and CAGGTACGCAGCAGTATGGAAGG) and an ssODN template with CRISPR/Cas9 technology. This knockout mutation only affects the transcript encoding the shorter liver-specific L-isozyme, which uses an alternative 1st exon downstream from the longer R-isozyme encoding transcript's exon 1. (J:342736)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pklr Mutation:  25 strains or lines available
References
Original:  J:342736 Zhang C, et al., Discovery of therapeutic agents targeting PKLR for NAFLD using drug repositioning. EBioMedicine. 2022 Aug 18;83:104214
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory