About   Help   FAQ
Mybpc3em1Mtc
Endonuclease-mediated Allele Detail
Summary
Symbol: Mybpc3em1Mtc
Name: myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Michael T Chin
MGI ID: MGI:7571382
Synonyms: Mybpc3Trunc, Mybpc3Y838X
Gene: Mybpc3  Location: Chr2:90948489-90966861 bp, + strand  Genetic Position: Chr2, 50.44 cM, cytoband E1
Alliance: Mybpc3em1Mtc page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 845 (TAT) in exon 25 was changed to a stop codon (TAA) (ENSMUSP00000107058:p.Y845*) using an sgRNA (targeting CCTATGAGATGCGAGTCTACGCA) and an ssODN template with CRISPR/Cas9 technology. (J:342762)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mybpc3 Mutation:  41 strains or lines available
References
Original:  J:342762 Chou C, et al., A novel alphaB-crystallin R123W variant drives hypertrophic cardiomyopathy by promoting maladaptive calcium-dependent signal transduction. Front Cardiovasc Med. 2023;10:1223244
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory