Dsg2^em1Spin
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dsg2^em1Spin
• Name: desmoglein 2; endonuclease-mediated mutation 1, Volker Spindler
• MGI ID: MGI:7570178
• Synonyms: DSG2-W2A
• Gene: Dsg2 Location: Chr18:20691131-20737578 bp, + strand Genetic Position: Chr18, 11.42 cM
• Alliance: Dsg2^em1Spin page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Tryptophan codon 56 (TGG) in exon 3 was changed to alanine (GCT) (p.W56A) using an sgRNA (targeting TGGTTCGTCAAAAGAGGGCCTGG) and an ssODN template with CRISPR/Cas9 technology. (J:342765)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dsg2 Mutation: 79 strains or lines available

References

• Original: J:342765 Schinner C, et al., Defective Desmosomal Adhesion Causes Arrhythmogenic Cardiomyopathy by Involving an Integrin-alphaVbeta6/TGF-beta Signaling Cascade. Circulation. 2022 Nov 22;146(21):1610-1626
• All: 1 reference(s)