Sqstm1^em1Kmts
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sqstm1^em1Kmts
• Name: sequestosome 1; endonuclease-mediated mutation 1, Masaaki Komatsu
• MGI ID: MGI:7570167
• Synonyms: p62^S351E
• Gene: Sqstm1 Location: Chr11:50090193-50101654 bp, - strand Genetic Position: Chr11, 30.36 cM, cytoband B1.2
• Alliance: Sqstm1^em1Kmts page

Mutation origin

• Germline Transmission: Not Specified
• Parent Cell Line: RENKA (ES Cell)
• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Constitutively active)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 351 (TCT) was changed to glutamic acid (GAG) (p.S351E) using a pegRNA (containing target-binding sequence GACUGGAGUUCACCUGUAGA and template GUGGACCCAGAG) with the prime editing system. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphomimetic, rendering the peptide permanently activated. (J:342766)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sqstm1 Mutation: 32 strains or lines available

References

• Original: J:342766 Ikeda R, et al., Phosphorylation of phase-separated p62 bodies by ULK1 activates a redox-independent stress response. EMBO J. 2023 Jul 17;42(14):e113349
• All: 1 reference(s)