About   Help   FAQ
Sqstm1em1Kmts
Endonuclease-mediated Allele Detail
Summary
Symbol: Sqstm1em1Kmts
Name: sequestosome 1; endonuclease-mediated mutation 1, Masaaki Komatsu
MGI ID: MGI:7570167
Synonyms: p62S351E
Gene: Sqstm1  Location: Chr11:50090193-50101654 bp, - strand  Genetic Position: Chr11, 30.36 cM, cytoband B1.2
Alliance: Sqstm1em1Kmts page
Mutation
origin
Germline Transmission:  Not Specified
Parent Cell Line:  RENKA (ES Cell)
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Constitutively active)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 351 (TCT) was changed to glutamic acid (GAG) (p.S351E) using a pegRNA (containing target-binding sequence GACUGGAGUUCACCUGUAGA and template GUGGACCCAGAG) with the prime editing system. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphomimetic, rendering the peptide permanently activated. (J:342766)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Sqstm1 Mutation:  35 strains or lines available
References
Original:  J:342766 Ikeda R, et al., Phosphorylation of phase-separated p62 bodies by ULK1 activates a redox-independent stress response. EMBO J. 2023 Jul 17;42(14):e113349
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory