About   Help   FAQ
Dnaaf5em3Slb
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnaaf5em3Slb
Name: dynein, axonemal assembly factor 5; endonuclease-mediated mutation 3, Steven L Brody
MGI ID: MGI:7569317
Gene: Dnaaf5  Location: Chr5:139135978-139172265 bp, + strand  Genetic Position: Chr5, 78.02 cM
Alliance: Dnaaf5em3Slb page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA 21 bp deletion was created in exon 4 (CAGACAGCCACCAGCCTATGG) using an sgRNA (targeting GCAGACAGCCACCAGCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The in-frame deletion, at the 5' end of the exon, may affect the splice acceptor site and deletes codons for critical residues in the encoded peptide. (J:342770)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dnaaf5 Mutation:  46 strains or lines available
References
Original:  J:342770 Horani A, et al., The effect of Dnaaf5 gene dosage on primary ciliary dyskinesia phenotypes. JCI Insight. 2023 Jun 8;8(11)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory