Dnaaf5^em2Slb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnaaf5^em2Slb
• Name: dynein, axonemal assembly factor 5; endonuclease-mediated mutation 2, Steven L Brody
• MGI ID: MGI:7569249
• Synonyms: Dnaaf5^FS
• Gene: Dnaaf5 Location: Chr5:139135978-139172265 bp, + strand Genetic Position: Chr5, 78.02 cM
• Alliance: Dnaaf5^em2Slb page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Cysteine codon 498 (TGT) in exon 7 was targeted for change to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. This allele contains an unintended 7 bp deletion in exon 7 (c.1476_1482delGGAGCAT), leading to a frameshift and premature stop codon (p.E493fs*28). (J:342770)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnaaf5 Mutation: 48 strains or lines available

References

• Original: J:342770 Horani A, et al., The effect of Dnaaf5 gene dosage on primary ciliary dyskinesia phenotypes. JCI Insight. 2023 Jun 8;8(11)
• All: 1 reference(s)