About   Help   FAQ
Nplem1Avps
Endonuclease-mediated Allele Detail
Summary
Symbol: Nplem1Avps
Name: N-acetylneuraminate pyruvate lyase; endonuclease-mediated mutation 1, Alexey Pshezhetsky
MGI ID: MGI:7567785
Synonyms: NplR63C
Gene: Npl  Location: Chr1:153378762-153425460 bp, - strand  Genetic Position: Chr1, 65.38 cM, cytoband G2
Alliance: Nplem1Avps page
Mutation
origin
Strain of Origin:  C57BL/6NHsd
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 63 (CGT) in exon 4 was changed to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with sialic acid metabolism disorder leading to cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss. Transcripts are expressed from this allele but not proteins. (J:342764)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Npl Mutation:  38 strains or lines available
References
Original:  J:342764 Da Silva A, et al., N-acetylneuraminate pyruvate lyase controls sialylation of muscle glycoproteins essential for muscle regeneration and function. Sci Adv. 2023 Jun 30;9(26):eade6308
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory