Atp6v1b2em1Pcamp
Endonuclease-mediated Allele Detail
|
Symbol: |
Atp6v1b2em1Pcamp |
Name: |
ATPase, H+ transporting, lysosomal V1 subunit B2; endonuclease-mediated mutation 1, Philippe M Campeau |
MGI ID: |
MGI:7567698 |
Synonyms: |
Atp6v1b2emR506* |
Gene: |
Atp6v1b2 Location: Chr8:69541388-69566370 bp, + strand Genetic Position: Chr8, 33.88 cM
|
Alliance: |
Atp6v1b2em1Pcamp page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Arginine codon 506 (CGA) in exon 14 was changed to a stop codon (TAA) (p.R506*) using an sgRNA (targeting GAGCGAATTTTACCCTCGAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which truncates the encoded peptide by 6 C-terminal amino acids, is the equivalent of the human NM_001693.3:c.1516C>T p.R506* mutation associated with autosomal dominant congenital deafness with onychodystrophy (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS).
(J:342781)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Atp6v1b2 Mutation: |
42 strains or lines available
|
|
Original: |
J:342781 Rousseau J, et al., The ATP6V1B2 DDOD/DOORS-Associated p.Arg506* Variant Causes Hyperactivity and Seizures in Mice. Genes (Basel). 2023 Jul 27;14(8) |
All: |
1 reference(s) |
|