About   Help   FAQ
Mybpc3em1Dwdk
Endonuclease-mediated Allele Detail
Summary
Symbol: Mybpc3em1Dwdk
Name: myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Diederik W D Kuster
MGI ID: MGI:7567398
Synonyms: MYBPC32373insG, Mybpc3c.2373insG
Gene: Mybpc3  Location: Chr2:90948489-90966861 bp, + strand  Genetic Position: Chr2, 50.44 cM, cytoband E1
Alliance: Mybpc3em1Dwdk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Null/knockout)
Mutation:    Insertion
 
Mutation detailsA single G nucleotide was inserted/duplicated in exon 24 (ENSMUST00000111430:c.2382dupG, GRCm39:chr2:90961782dupG) using an sgRNA (targeting GGACTCCTGCACTGTGCAGTGGG) and an ssODN template with CRISPR/Cas9 technology. No protein expression was found from this allele in the left heart ventricle. The mutation creates a novel splice donor site (G-GT) the middle of the exon, the use of which leads to anomalous splicing, frameshift and premature stop codon; if the splice site is not used, the mutation will also create a frameshift and premature stop codon. It is the equivalent of a human c.2373insG (c.2373dupG) mutation associated with hypertrophic cardiomyopathy (HCM). (J:342830)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mybpc3 Mutation:  41 strains or lines available
References
Original:  J:342830 Schuldt M, et al., Proteomic and Functional Studies Reveal Detyrosinated Tubulin as Treatment Target in Sarcomere Mutation-Induced Hypertrophic Cardiomyopathy. Circ Heart Fail. 2021 Jan;14(1):e007022
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory